Pipeta - strona 9

Bilans jonowy wody - sprawozdanie

  • Akademia Górniczo-Hutnicza im. Stanisława Staszica w Krakowie
  • Agnieszka Gala
  • Technologia wody i ścieków
Pobrań: 728
Wyświetleń: 2940

. Następnie do trzech kolb stożkowych odmierzono po 200cm3 badanej wody. Do odmierzonych próbek dodano pipetą...

MODELOWANIE ARCHICAD - Kursor

  • Politechnika Warszawska
  • dr Adam Dolot
  • Architektura i urbanistyka
Pobrań: 63
Wyświetleń: 2107

do automatyzacji niektórych czynnoĞci, takich jak Ğledzenie obwodu Ğciany czy tworzenie granic wypełnieĔ, pipeta...

Ćwiczenia 3: Amplifikacja PCR

  • Uniwersytet Przyrodniczy we Wrocławiu
  • dr Karol Sakowicz
  • Biologia molekularna
Pobrań: 287
Wyświetleń: 1792

 GCCCATTTCGCCTTCTCTGTAACAGA 3 - pipety P-2, P-10, P-20 - końcówki do pipet P-2, P-10, P-20 - marker laboratoryjny - pojemnik...

Charakterystyka wyrobów szklanych

  • Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowie
  • Towaroznawstwo Artykułów Przemysłowych
Pobrań: 182
Wyświetleń: 1960

miarowe, pipety, biurety , cylindry, eksykatory, Szkło budowlane :płyty wykładzinowe, szkło piankowe, wata...

Przewietrzanie kopalń - wykład

  • Politechnika Śląska
  • prof. dr hab. inż. Piotr Strzałkowski
  • Górnictwo ogólne
Pobrań: 168
Wyświetleń: 2233

kopalnianego pobiera się do specjalnych naczyń, zwanych pipetami. Najczęściej używa się pipet szklanych...

Sprawozdanie- profil topnienia

  • Politechnika Wrocławska
  • Biochemia
Pobrań: 532
Wyświetleń: 1764

dezoksyrybonukleinowego - roztwór DNA w SSC, Olej parafinowy. Szkło i aparatura Pipety automatyczne oraz tipsy, Kuwety...