Ćwiczenia 3: Amplifikacja PCR

Nasza ocena:

5
Pobrań: 287
Wyświetleń: 1792
Komentarze: 0
Notatek.pl

Pobierz ten dokument za darmo

Podgląd dokumentu
Ćwiczenia 3: Amplifikacja PCR - strona 1 Ćwiczenia 3: Amplifikacja PCR - strona 2 Ćwiczenia 3: Amplifikacja PCR - strona 3

Fragment notatki:


Ćwiczenie 3. Amplifikacja PCR W   1983   roku   Kary   Mullis,   amerykański   biochemik,   wynalazł   fundamentalną   dla   biologii  molekularnej   technikę   łańcuchowej   reakcji   polimerazy   PCR   (ang.   Polymerase   Chain   Reaction ),   która  zrewolucjonizowała badania genetyczne. Celem PCR jest wyprodukowanie dużej ilości DNA z próby, zaczynając tylko od śladowej ilości. Te  śladowe ilości genomowego DNA np. z pojedynczej cebulki włosowej, kropli krwi, czy innych płynów  ustrojowych wystarczają do syntezy milionów kopii fragmentu DNA. Wynalezienie PCR odegrało bardzo  duże   rolę   w   czterech   głównych   obszarach   badań   genetycznych:   mapowanie   genów,   klonowanie,  sekwencjonowanie DNA i detekcja genów, między innymi w pracach nad genomem człowieka. Obecnie  PCR używany jest jako narzędzie diagnostyczne do wykrywania mutacji, które mogą powodować choroby  genetyczne. Wykorzystuje się go również w kryminalistyce oraz medycynie sądowej do identyfikacji na  poziomie molekularnym  osób podejrzanych o popełnienie przestępstwa. Na dzień dzisiejszy technika ta  stosowana jest już na duża skalę w rolnictwie, w hodowli zwierząt i roślin. Powielenie konkretnego fragmentu DNA wymaga mieszaniny składającej się z następujących odczynników:  sekwencji DNA, która będzie amplifikowana;  poszczególnych zasad deoksyrybonukleotydów (A, T, G, C), które są podstawowymi jednostkami  budulcowymi DNA;  polimerazy Taq – enzymu, który składa nukleotydy w nową molekułę DNA;  jonów magnezu – kofaktora potrzebnego polimerazie do stworzenia nowego łańcucha DNA;  starterów – sztucznie syntetyzowanych krótkich fragmentów DNA komplementarnych do matrycy,  będących punktem startu dla działania polimerazy;  buforu   –   utrzymującego   odpowiednie   środowisko   i  pH   dla   działania   polimerazy   i  przyłączania  starterów. PCR wykorzystuje te same podstawowe procesy co komórka organizmu do skopiowania swojego DNA - hybrydyzacja komplementarnej nici DNA - synteza nici DNA poprzez polimerazę Taq Do   rozpoczęcia   procesu   amplifikacji   niezbędne   są   statery.   Są   to   specjalnie   zaprojektowane  oligonuklotydy, które przyłączają się do końców sekwencji DNA interesującego nas genu i stanowią sygnał  dla polimerazy do rozpoczęcia kopiowania DNA. Startery są to dwie krótkie pojedynczej nici DNA (ok. 20- 25 nukleotydów). Wyróżniamy dwa typy starterów: starter przedni (ang.   forward)   – jego sekwencja musi 

(…)

… mleka kappakazeiny
Lista materiałów
- DNA wyizolowane na poprzednich ćwiczeniach
- woda dejonizowana
- bufor
- MgCl2
- dNTP
- polimeraza Taq
- sekwencje starterów dla kappakazeiny:
przedni (F) 5 ATCATTTATGGCCATTCCACCAAAG 3
wsteczny (R) 5 GCCCATTTCGCCTTCTCTGTAACAGA 3
- pipety P-2, P-10, P-20
- końcówki do pipet P-2, P-10, P-20
- marker laboratoryjny
- pojemnik na odpady
- rękawiczki laboratoryjne…
... zobacz całą notatkę

Komentarze użytkowników (0)

Zaloguj się, aby dodać komentarz