nośniki informacji genetycznej - omówienie

Nasza ocena:

3
Pobrań: 210
Wyświetleń: 875
Komentarze: 0
Notatek.pl

Pobierz ten dokument za darmo

Podgląd dokumentu
nośniki informacji genetycznej - omówienie - strona 1 nośniki informacji genetycznej - omówienie - strona 2

Fragment notatki:

Informacja strukturalna - stopień uporządkowania danego układu.
Priony - infekcyjne białka, występujące powszechnie w każdym organizmie, w pierwotnej postaci są niegroźne. Dopiero gdy zmienią swój układ przestrzenny (konformacja - bez zrywania wiązań chemicznych, ale ze zmianą właściwości fizykochemicznych) stają się białkiem prionowym infekcyjnym. Są one przyczyną takich chorób jak Creutzfeldta-Jakoba, śmiertelna bezsenność oraz BSE u bydła. Samoorganizacja - element hipotezy „Świata RNA”. Zakłada ona ewolucję chemiczną w wyniku których z prostych związków nieorganicznych powstały skomplikowane związki organiczne (doświadczenie w punkcie nr 11), SAMOORGANIZACJĘ powstałych związków w replikujące się struktury (etap przejścia martwych kompleksów organicznych do pierwszych organizmów żywych), a także ewolucję biologiczną prowadzącą do dzisiejszej różnorodności form życia.
Nośnikami informacji genetycznej nazywamy kwasy rybonukleinowe RNA i deoksyrybonukleinowe DNA. Informację genetyczną stanowi chemicznie zapisana kolejność deoksyrybonukleotydów (głównie w jądrach komórkowych). Informacja te za pomocą transkrypcji jest przepisywana i przekazywana do cytoplazmy w formie sekwencji polirybonukleotydowej łańcuchów RNA. Na podstawie nici mRNA tworzone są białka (zapewniające prawidłowe funkcjonowanie komórki).
Znaczenie cząstek amfifilowych - są to cząstki posiadające zdolność rozpuszczalności w dwóch różnych substancjach (np. cząstka z jednym końcem hydrofilowym, a drugim hydrofobowym). Dzięki takiej właśnie właściwości lipidy tworzą ściany błony komórkowej, a także możliwe są niektóre przemiany enzymatyczne. Rybozymy - substancje zbudowane z kwasu rybonukleinowego RNA, zdolne do katalizowania pewnych reakcji chemicznych. Występują u wszystkich organizmów żywych, przede wszystkim w mechanizmie syntezy białek oraz przemian kwasów nukleinowych. Pełnią też inne funkcje - m.in. wchodzą w skład wielu wirusów. Pojawiły się już badania nad użyciem ich w leczeniu różnych chorób - np. zakażenia wirusem HIV oraz w terapii genowej. Sekwencjonowanie DNA
Sekwencjonowanie DNA - technika odczytywania sekwencji, czyli kolejności par nukleotydowych w cząsteczce DNA. Sekwencjonowanie dokonuje się przy pomocy zautomatyzowanych sekwencjonatorów.
Przykład sekwencji DNA
GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGG
gdzie: A - adenina; C - cytozyna; G - guanina; T - tymina
Pseudogeny
Pseudogen  - niedziałająca kopia genu, na przykład zawierająca błędy w obszarze kodującym co sprawia, że zawartej w nim informacji genetycznej nie można odczytać. Pseudogeny powstają na drodze

(…)

… zasad (kodonu);
Bezprzecinkowy - między trójkami kodującymi nie ma dodatkowych elementów;
Zdegenerowany - jeden aminokwas może być kodowany przez kilka różnych trójek;
Uniwersalny - kod genetyczny taki sam we wszystkich organizmach;
Jednoznaczny - każda trójka koduje jeden i ten sam rodzaj aminokwasu;
Niezachodzący - kodony nie zachodzą na siebie.
Mutacje chromosomowe liczbowe obejmują największe…
... zobacz całą notatkę

Komentarze użytkowników (0)

Zaloguj się, aby dodać komentarz